Basic information for AL158064.1-207-10aa-2
| Peptide Name | AL158064.1-207-10aa-2 |
| Genome Position | chr13:80042287-80042316[-] |
| Species | Human |
| Peptide Sequence | MAFVVVTASF |
| Peptide Length | 10 |
| Unique | No (AL158064.1-202-10aa-2,AL158064.1-204-10aa-1,AL158064.1-203-10aa-2,AL158064.1-208-10aa-1) |
| Grand Average of Hydropathicity | 2.22 |
| Relative Molecular Mass | 1233.47 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000284196;AL158064.1 |
| Transcript ID/Name | ENST00000666462;AL158064.1-207 |
| Transcript Length | 1617 |
| Coding Ability | 0.3871 |
| DNA Sequence Corresponding to Peptide | ATGGCTTTTGTGGTAGTTACTGCTTCTTTT |
|
Conservation
|
|
|