Basic information for AL158832.2-201-10aa-1
| Peptide Name | AL158832.2-201-10aa-1 |
| Genome Position | chr9:197698-197727[-] |
| Species | Human |
| Peptide Sequence | MVGTGGPYVK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.16 |
| Relative Molecular Mass | 1170.39 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287480;AL158832.2 |
| Transcript ID/Name | ENST00000657756;AL158832.2-201 |
| Transcript Length | 1613 |
| Coding Ability | 0.4687 |
| DNA Sequence Corresponding to Peptide | ATGGTTGGAACTGGAGGACCTTATGTTAAG |
|
Conservation
|
|
|