Basic information for AL163952.1-202-10aa
| Peptide Name | AL163952.1-202-10aa |
| Genome Position | chr14:55915927-55915956[+] |
| Species | Human |
| Peptide Sequence | MKAFLSTPAL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.89 |
| Relative Molecular Mass | 1240.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000259868;AL163952.1 |
| Transcript ID/Name | ENST00000569625;AL163952.1-202 |
| Transcript Length | 600 |
| Coding Ability | 0.44 |
| DNA Sequence Corresponding to Peptide | ATGAAAGCTTTCCTCAGTACTCCTGCCCTA |
|
Conservation
|
|
|