Basic information for AL353576.1-204-10aa
| Peptide Name | AL353576.1-204-10aa |
| Genome Position | chr10:16526635-16526664[+] |
| Species | Human |
| Peptide Sequence | MDVTLYTCHT |
| Peptide Length | 10 |
| Unique | No (AL353576.1-203-10aa-1) |
| Grand Average of Hydropathicity | 0.23 |
| Relative Molecular Mass | 1345.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287925;AL353576.1 |
| Transcript ID/Name | ENST00000669251;AL353576.1-204 |
| Transcript Length | 1661 |
| Coding Ability | 0.307 |
| DNA Sequence Corresponding to Peptide | ATGGATGTGACACTTTATACCTGCCATACA |
|
Conservation
|
|
|