Basic information for AL353803.1-202-10aa
| Peptide Name | AL353803.1-202-10aa |
| Genome Position | chr9:129447342-129447371[+] |
| Species | Human |
| Peptide Sequence | MFGHVTCVSQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.7 |
| Relative Molecular Mass | 1270.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000226355;AL353803.1 |
| Transcript ID/Name | ENST00000655097;AL353803.1-202 |
| Transcript Length | 946 |
| Coding Ability | 0.3182 |
| DNA Sequence Corresponding to Peptide | ATGTTTGGCCACGTGACTTGCGTTAGCCAG |
|
Conservation
|
|
|