Basic information for AL355347.1-201-10aa
| Peptide Name | AL355347.1-201-10aa |
| Genome Position | chr6:61892975-61893004[+] |
| Species | Human |
| Peptide Sequence | MGENFHNLLI |
| Peptide Length | 10 |
| Unique | No (AC092661.1-201-10aa-2) |
| Grand Average of Hydropathicity | 0.27 |
| Relative Molecular Mass | 1349.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287679;AL355347.1 |
| Transcript ID/Name | ENST00000658037;AL355347.1-201 |
| Transcript Length | 4260 |
| Coding Ability | 0.304 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTCACAACCTACTCATC |
|
Conservation
|
|
|