Basic information for AL356599.1-218-10aa
| Peptide Name | AL356599.1-218-10aa |
| Genome Position | chr6:145884047-145884076[+] |
| Species | Human |
| Peptide Sequence | MISYFIHLTG |
| Peptide Length | 10 |
| Unique | No (AL356599.1-204-10aa,AL356599.1-208-10aa,AL356599.1-205-10aa,AL356599.1-214-10aa) |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1343.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000235652;AL356599.1 |
| Transcript ID/Name | ENST00000591489;AL356599.1-218 |
| Transcript Length | 1461 |
| Coding Ability | 0.2512 |
| DNA Sequence Corresponding to Peptide | ATGATTTCTTACTTTATCCACCTGACAGGA |
|
Conservation
|
|
|