Basic information for AL357141.1-201-10aa-1
| Peptide Name | AL357141.1-201-10aa-1 |
| Genome Position | chr6:116046164-116046193[+] |
| Species | Human |
| Peptide Sequence | MLYTVGGSLH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.69 |
| Relative Molecular Mass | 1239.44 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000287933;AL357141.1 |
| Transcript ID/Name | ENST00000663064;AL357141.1-201 |
| Transcript Length | 5637 |
| Coding Ability | 0.4659 |
| DNA Sequence Corresponding to Peptide | ATGCTTTACACCGTTGGTGGGAGTCTACAT |
m6A
|
Conservation
|
|
|