Basic information for AL360270.2-201-10aa-3
| Peptide Name | AL360270.2-201-10aa-3 |
| Genome Position | chr1:110938501-110938530[-] |
| Species | Human |
| Peptide Sequence | MPACYLYVFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.56 |
| Relative Molecular Mass | 1415.67 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000261654;AL360270.2 |
| Transcript ID/Name | ENST00000562952;AL360270.2-201 |
| Transcript Length | 5985 |
| Coding Ability | 0.3794 |
| DNA Sequence Corresponding to Peptide | ATGCCTGCTTGCTATTTGTATGTCTTCTTT |
|
Conservation
|
|
|