Basic information for AL583827.1-203-10aa-3
| Peptide Name | AL583827.1-203-10aa-3 |
| Genome Position | chr9:85371633-85371662[-] |
| Species | Human |
| Peptide Sequence | MFPIILKQLD |
| Peptide Length | 10 |
| Unique | No (AL603840.1-203-10aa-2,AL583827.1-201-10aa-2,AL583827.1-202-10aa-2) |
| Grand Average of Hydropathicity | 0.88 |
| Relative Molecular Mass | 1379.65 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285634;AL583827.1 |
| Transcript ID/Name | ENST00000662737;AL583827.1-203 |
| Transcript Length | 4264 |
| Coding Ability | 0.4981 |
| DNA Sequence Corresponding to Peptide | ATGTTCCCCATCATCCTGAAGCAGCTGGAT |
|
Conservation
|
|
|