Basic information for AL590807.1-206-10aa-2
| Peptide Name | AL590807.1-206-10aa-2 |
| Genome Position | chr13:80985586-80985615[-] |
| Species | Human |
| Peptide Sequence | MGEHFCNLLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.87 |
| Relative Molecular Mass | 1338.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286746;AL590807.1 |
| Transcript ID/Name | ENST00000655229;AL590807.1-206 |
| Transcript Length | 4354 |
| Coding Ability | 0.4763 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAACATTTTTGCAATCTACTCATC |
|
Conservation
|
|
|