Basic information for AL591501.1-202-10aa-2
| Peptide Name | AL591501.1-202-10aa-2 |
| Genome Position | chrX:34345658-34345687[+] |
| Species | Human |
| Peptide Sequence | MGEIFCNLPT |
| Peptide Length | 10 |
| Unique | No (AL591501.1-208-10aa-2) |
| Grand Average of Hydropathicity | 0.58 |
| Relative Molecular Mass | 1286.51 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000233928;AL591501.1 |
| Transcript ID/Name | ENST00000668394;AL591501.1-202 |
| Transcript Length | 3562 |
| Coding Ability | 0.4618 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAATTTTTTGCAATCTACCCACC |
|
Conservation
|
|
|