Basic information for AL591501.1-206-10aa-2
| Peptide Name | AL591501.1-206-10aa-2 |
| Genome Position | chrX:33915553-33915582[+] |
| Species | Human |
| Peptide Sequence | MFKLLQVILI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.19 |
| Relative Molecular Mass | 1379.74 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000233928;AL591501.1 |
| Transcript ID/Name | ENST00000665499;AL591501.1-206 |
| Transcript Length | 3928 |
| Coding Ability | 0.4325 |
| DNA Sequence Corresponding to Peptide | ATGTTTAAGCTTCTACAAGTTATATTAATA |
|
Conservation
|
|
|