Basic information for AL603840.1-203-10aa-1
| Peptide Name | AL603840.1-203-10aa-1 |
| Genome Position | chr1:55732055-55732084[+] |
| Species | Human |
| Peptide Sequence | MLFGAFGRPP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.46 |
| Relative Molecular Mass | 1254.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000234810;AL603840.1 |
| Transcript ID/Name | ENST00000422374;AL603840.1-203 |
| Transcript Length | 4063 |
| Coding Ability | 0.2894 |
| DNA Sequence Corresponding to Peptide | ATGCTGTTTGGAGCCTTTGGCAGGCCCCCA |
|
Conservation
|
|
|