Basic information for AL671883.3-201-10aa
| Peptide Name | AL671883.3-201-10aa |
| Genome Position | chr6:31375225-31375254[+] |
| Species | Human |
| Peptide Sequence | MEESISLFQV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.51 |
| Relative Molecular Mass | 1344.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285647;AL671883.3 |
| Transcript ID/Name | ENST00000649421;AL671883.3-201 |
| Transcript Length | 1480 |
| Coding Ability | 0.4716 |
| DNA Sequence Corresponding to Peptide | ATGGAAGAATCCATCTCCCTCTTTCAGGTG |
|
Conservation
|
|
|