Basic information for AL731769.2-202-10aa
| Peptide Name | AL731769.2-202-10aa |
| Genome Position | chr10:133628539-133628568[+] |
| Species | Human |
| Peptide Sequence | MCFYLSFNLR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.75 |
| Relative Molecular Mass | 1455.69 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000288107;AL731769.2 |
| Transcript ID/Name | ENST00000655152;AL731769.2-202 |
| Transcript Length | 2420 |
| Coding Ability | 0.3678 |
| DNA Sequence Corresponding to Peptide | ATGTGTTTTTATTTGTCCTTTAATCTCAGG |
|
Conservation
|
|
|