Basic information for AP000289.1-202-10aa
| Peptide Name | AP000289.1-202-10aa |
| Genome Position | chr21:33110867-33110876,33114604-33114623[-] |
| Species | Human |
| Peptide Sequence | MALCKTKLGF |
| Peptide Length | 10 |
| Unique | No (AP000289.1-203-10aa) |
| Grand Average of Hydropathicity | 0.77 |
| Relative Molecular Mass | 1273.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000226527;AP000289.1 |
| Transcript ID/Name | ENST00000657804;AP000289.1-202 |
| Transcript Length | 2264 |
| Coding Ability | 0.6497 |
| DNA Sequence Corresponding to Peptide | ATGGCTCTCTGCAAGACCAAGCTTGGATTT |
|
Conservation
|
|
|