Basic information for AP000542.2-201-10aa-2
| Peptide Name | AP000542.2-201-10aa-2 |
| Genome Position | chr22:15303141-15303170[-] |
| Species | Human |
| Peptide Sequence | MNKILLLCTQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.87 |
| Relative Molecular Mass | 1338.67 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279442;AP000542.2 |
| Transcript ID/Name | ENST00000623199;AP000542.2-201 |
| Transcript Length | 6179 |
| Coding Ability | 0.4169 |
| DNA Sequence Corresponding to Peptide | ATGAATAAGATTCTTCTTTTATGTACTCAA |
|
Conservation
|
|
|