Basic information for AP000561.1-203-10aa-2
| Peptide Name | AP000561.1-203-10aa-2 |
| Genome Position | chr21:22409185-22409214[+] |
| Species | Human |
| Peptide Sequence | MIFQEVFLIF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.03 |
| Relative Molecular Mass | 1448.72 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000226043;AP000561.1 |
| Transcript ID/Name | ENST00000667099;AP000561.1-203 |
| Transcript Length | 1482 |
| Coding Ability | 0.2848 |
| DNA Sequence Corresponding to Peptide | ATGATATTTCAGGAAGTATTTCTCATATTT |
|
Conservation
|
|
|