Basic information for AP000787.1-207-10aa-2
| Peptide Name | AP000787.1-207-10aa-2 |
| Genome Position | chr11:95233083-95233112[+] |
| Species | Human |
| Peptide Sequence | MVWGRCLRFS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.41 |
| Relative Molecular Mass | 1416.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000245552;AP000787.1 |
| Transcript ID/Name | ENST00000540692;AP000787.1-207 |
| Transcript Length | 1201 |
| Coding Ability | 0.3797 |
| DNA Sequence Corresponding to Peptide | ATGGTGTGGGGAAGGTGCTTAAGATTCAGT |
|
Conservation
|
|
|