Basic information for AP000894.4-201-10aa
| Peptide Name | AP000894.4-201-10aa |
| Genome Position | chr18:813519-813548[+] |
| Species | Human |
| Peptide Sequence | MCQYSGILGT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.56 |
| Relative Molecular Mass | 1234.44 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000273355;AP000894.4 |
| Transcript ID/Name | ENST00000610185;AP000894.4-201 |
| Transcript Length | 483 |
| Coding Ability | 0.3354 |
| DNA Sequence Corresponding to Peptide | ATGTGTCAGTATTCCGGTATTCTAGGAACT |
m6A
|
Conservation
|
|
|