Basic information for AP001025.1-201-10aa
| Peptide Name | AP001025.1-201-10aa |
| Genome Position | chr18:3327340-3327369[+] |
| Species | Human |
| Peptide Sequence | MTAAPDNICP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.16 |
| Relative Molecular Mass | 1194.36 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000266578;AP001025.1 |
| Transcript ID/Name | ENST00000578787;AP001025.1-201 |
| Transcript Length | 1180 |
| Coding Ability | 0.3771 |
| DNA Sequence Corresponding to Peptide | ATGACGGCAGCCCCAGACAACATCTGTCCT |
|
Conservation
|
|
|