Basic information for AP001541.1-201-10aa
| Peptide Name | AP001541.1-201-10aa |
| Genome Position | chr11:79967079-79967108[+] |
| Species | Human |
| Peptide Sequence | MPCHAQITLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1262.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279295;AP001541.1 |
| Transcript ID/Name | ENST00000623322;AP001541.1-201 |
| Transcript Length | 1904 |
| Coding Ability | 0.4617 |
| DNA Sequence Corresponding to Peptide | ATGCCATGTCATGCCCAAATAACATTGAGT |
|
Conservation
|
|
|