Basic information for AP005230.1-205-10aa-2
| Peptide Name | AP005230.1-205-10aa-2 |
| Genome Position | chr18:2489194-2489223[-] |
| Species | Human |
| Peptide Sequence | MAINFFQPLP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1339.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000263745;AP005230.1 |
| Transcript ID/Name | ENST00000639316;AP005230.1-205 |
| Transcript Length | 4286 |
| Coding Ability | 0.3572 |
| DNA Sequence Corresponding to Peptide | ATGGCCATAAATTTTTTTCAGCCTCTCCCA |
|
Conservation
|
|
|