Basic information for AP005230.1-206-10aa-2
| Peptide Name | AP005230.1-206-10aa-2 |
| Genome Position | chr18:2035087-2035116[-] |
| Species | Human |
| Peptide Sequence | MWLLHIYSVT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.13 |
| Relative Molecular Mass | 1424.69 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000263745;AP005230.1 |
| Transcript ID/Name | ENST00000670529;AP005230.1-206 |
| Transcript Length | 1395 |
| Coding Ability | 0.4136 |
| DNA Sequence Corresponding to Peptide | ATGTGGCTCCTACATATTTATTCAGTTACA |
m6A
|
Conservation
|
|
|