Basic information for AP005230.1-208-10aa
| Peptide Name | AP005230.1-208-10aa |
| Genome Position | chr18:2034272-2034301[-] |
| Species | Human |
| Peptide Sequence | MSIQEGKCLL |
| Peptide Length | 10 |
| Unique | No (AP005230.1-204-10aa,AP005230.1-203-10aa-1,AP005230.1-206-10aa-1,AP005230.1-207-10aa) |
| Grand Average of Hydropathicity | 0.44 |
| Relative Molecular Mass | 1283.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000263745;AP005230.1 |
| Transcript ID/Name | ENST00000659989;AP005230.1-208 |
| Transcript Length | 1365 |
| Coding Ability | 0.4432 |
| DNA Sequence Corresponding to Peptide | ATGAGTATTCAAGAAGGAAAGTGTTTGCTT |
|
Conservation
|
|
|