Basic information for AP005432.1-201-10aa-3
| Peptide Name | AP005432.1-201-10aa-3 |
| Genome Position | chr18:9509486-9509515[+] |
| Species | Human |
| Peptide Sequence | MYSSCYLVEL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.85 |
| Relative Molecular Mass | 1369.55 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000266805;AP005432.1 |
| Transcript ID/Name | ENST00000580891;AP005432.1-201 |
| Transcript Length | 3485 |
| Coding Ability | 0.4103 |
| DNA Sequence Corresponding to Peptide | ATGTATAGTTCCTGTTACCTTGTTGAACTC |
m6A
|
Conservation
|
|
|