Basic information for C230035I16Rik-202-10aa
| Peptide Name | C230035I16Rik-202-10aa |
| Genome Position | chr13:23428348-23428377[-] |
| Species | Mouse |
| Peptide Sequence | MQSLLLAFHN |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.69 |
| Relative Molecular Mass | 1335.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000085024;C230035I16Rik |
| Transcript ID/Name | ENSMUST00000153753;C230035I16Rik-202 |
| Transcript Length | 643 |
| Coding Ability | 0.2644 |
| DNA Sequence Corresponding to Peptide | ATGCAGTCTCTGCTCCTAGCCTTTCATAAC |
|
Conservation
|
|
|