Basic information for CCDC26-206-10aa-1
| Peptide Name | CCDC26-206-10aa-1 |
| Genome Position | chr8:128954880-128954909[-] |
| Species | Human |
| Peptide Sequence | MVLGKLASHR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.27 |
| Relative Molecular Mass | 1273.5 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000625513;CCDC26-206 |
| Transcript Length | 783 |
| Coding Ability | 0.3576 |
| DNA Sequence Corresponding to Peptide | ATGGTGCTGGGAAAACTGGCTAGCCATAGG |
|
Conservation
|
|
|