Basic information for CCDC26-206-10aa-2
| Peptide Name | CCDC26-206-10aa-2 |
| Genome Position | chr8:128955183-128955212[-] |
| Species | Human |
| Peptide Sequence | MGENFCNLPI |
| Peptide Length | 10 |
| Unique | No (HELLPAR-201-10aa-51,AC016074.2-201-10aa-1,AL157997.1-201-10aa-1,LINC02027-204-10aa) |
| Grand Average of Hydropathicity | 0.3 |
| Relative Molecular Mass | 1299.47 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000625513;CCDC26-206 |
| Transcript Length | 783 |
| Coding Ability | 0.3576 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTTGCAATCTACCCATC |
|
Conservation
|
|
|