Basic information for CCDC26-210-10aa-1
| Peptide Name | CCDC26-210-10aa-1 |
| Genome Position | chr8:128637345-128637374[-] |
| Species | Human |
| Peptide Sequence | MANDGKLLKI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.06 |
| Relative Molecular Mass | 1264.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000643616;CCDC26-210 |
| Transcript Length | 20097 |
| Coding Ability | 0.3225 |
| DNA Sequence Corresponding to Peptide | ATGGCCAATGATGGGAAATTACTCAAGATA |
|
Conservation
|
|
|