Basic information for CCDC26-212-10aa-3
| Peptide Name | CCDC26-212-10aa-3 |
| Genome Position | chr8:128905109-128905138[-] |
| Species | Human |
| Peptide Sequence | MIPFIVLRTL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.87 |
| Relative Molecular Mass | 1364.72 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000644557;CCDC26-212 |
| Transcript Length | 1147 |
| Coding Ability | 0.422 |
| DNA Sequence Corresponding to Peptide | ATGATTCCTTTTATTGTTCTTAGAACACTG |
|
Conservation
|
|
|