Basic information for CCDC26-227-10aa-2
| Peptide Name | CCDC26-227-10aa-2 |
| Genome Position | chr8:129399394-129399423[-] |
| Species | Human |
| Peptide Sequence | MYNLLFFPGH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.51 |
| Relative Molecular Mass | 1400.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000657069;CCDC26-227 |
| Transcript Length | 1287 |
| Coding Ability | 0.3186 |
| DNA Sequence Corresponding to Peptide | ATGTATAACCTTTTATTCTTCCCTGGTCAC |
|
Conservation
|
|
|