Basic information for CCDC26-253-10aa
| Peptide Name | CCDC26-253-10aa |
| Genome Position | chr8:129276736-129276765[-] |
| Species | Human |
| Peptide Sequence | MLYKHHVSLA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.31 |
| Relative Molecular Mass | 1360.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000665348;CCDC26-253 |
| Transcript Length | 1563 |
| Coding Ability | 0.2687 |
| DNA Sequence Corresponding to Peptide | ATGTTGTACAAGCACCATGTCTCTCTAGCT |
|
Conservation
|
|
|