Basic information for CCDC26-279-10aa-1
| Peptide Name | CCDC26-279-10aa-1 |
| Genome Position | chr8:129018625-129018654[-] |
| Species | Human |
| Peptide Sequence | MYLLGNISHP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.32 |
| Relative Molecular Mass | 1306.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000229140;CCDC26 |
| Transcript ID/Name | ENST00000671439;CCDC26-279 |
| Transcript Length | 1283 |
| Coding Ability | 0.4147 |
| DNA Sequence Corresponding to Peptide | ATGTATCTATTGGGTAATATTTCGCACCCT |
|
Conservation
|
|
|