Basic information for CPB2-AS1-215-10aa-4
| Peptide Name | CPB2-AS1-215-10aa-4 |
| Genome Position | chr13:46117056-46117085[+] |
| Species | Human |
| Peptide Sequence | MLNNILTNLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1320.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000235903;CPB2-AS1 |
| Transcript ID/Name | ENST00000667034;CPB2-AS1-215 |
| Transcript Length | 4300 |
| Coding Ability | 0.3886 |
| DNA Sequence Corresponding to Peptide | ATGCTTAACAACATTTTAACAAATTTAATT |
|
Conservation
|
|
|