Basic information for D7Bwg0826e-201-10aa-1
| Peptide Name | D7Bwg0826e-201-10aa-1 |
| Genome Position | chr7:44895247-44895276[-] |
| Species | Mouse |
| Peptide Sequence | MKVEVGLLDS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.58 |
| Relative Molecular Mass | 1252.43 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000109198;D7Bwg0826e |
| Transcript ID/Name | ENSMUST00000208484;D7Bwg0826e-201 |
| Transcript Length | 3795 |
| Coding Ability | 0.3647 |
| DNA Sequence Corresponding to Peptide | ATGAAGGTGGAGGTCGGGCTCCTGGACTCC |
|
Conservation
|
|
|