Basic information for DLEU2-204-10aa-5
| Peptide Name | DLEU2-204-10aa-5 |
| Genome Position | chr13:50044670-50044699[-] |
| Species | Human |
| Peptide Sequence | MYSVSFFCNL |
| Peptide Length | 10 |
| Unique | No (DLEU2-201-10aa-4,DLEU2L-201-10aa-2,DLEU2-207-10aa-4) |
| Grand Average of Hydropathicity | 1.16 |
| Relative Molecular Mass | 1372.56 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000231607;DLEU2 |
| Transcript ID/Name | ENST00000433070;DLEU2-204 |
| Transcript Length | 1208 |
| Coding Ability | 0.4048 |
| DNA Sequence Corresponding to Peptide | ATGTATTCTGTATCTTTCTTTTGTAATTTG |
m6A
|
Conservation
|
|
|