Basic information for DLEU2-215-10aa-2
| Peptide Name | DLEU2-215-10aa-2 |
| Genome Position | chr13:49979095-49979124[-] |
| Species | Human |
| Peptide Sequence | MGATVETQAT |
| Peptide Length | 10 |
| Unique | No (DLEU2-209-10aa,DLEU2-211-10aa,DLEU2-213-10aa-2,DLEU2-217-10aa-3) |
| Grand Average of Hydropathicity | 0.02 |
| Relative Molecular Mass | 1170.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231607;DLEU2 |
| Transcript ID/Name | ENST00000665220;DLEU2-215 |
| Transcript Length | 3077 |
| Coding Ability | 0.313 |
| DNA Sequence Corresponding to Peptide | ATGGGTGCCACCGTGGAGACCCAGGCAACC |
|
Conservation
|
|
|