Basic information for EIF1B-AS1-201-10aa-3
| Peptide Name | EIF1B-AS1-201-10aa-3 |
| Genome Position | chr3:40174284-40174313[-] |
| Species | Human |
| Peptide Sequence | MNETPLLSCC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.44 |
| Relative Molecular Mass | 1272.5 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000280739;EIF1B-AS1 |
| Transcript ID/Name | ENST00000625390;EIF1B-AS1-201 |
| Transcript Length | 1958 |
| Coding Ability | 0.4985 |
| DNA Sequence Corresponding to Peptide | ATGAATGAAACGCCTCTGTTGTCCTGCTGC |
m6A
|
Conservation
|
|
|