Basic information for EIF1B-AS1-205-10aa
| Peptide Name | EIF1B-AS1-205-10aa |
| Genome Position | chr3:40290078-40290107[-] |
| Species | Human |
| Peptide Sequence | MFQHLLSLLT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.17 |
| Relative Molecular Mass | 1364.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000280739;EIF1B-AS1 |
| Transcript ID/Name | ENST00000629723;EIF1B-AS1-205 |
| Transcript Length | 2446 |
| Coding Ability | 0.3949 |
| DNA Sequence Corresponding to Peptide | ATGTTCCAGCATCTTCTGTCCCTTCTCACC |
|
Conservation
|
|
|