Basic information for EIF1B-AS1-206-10aa-2
| Peptide Name | EIF1B-AS1-206-10aa-2 |
| Genome Position | chr3:40242207-40242236[-] |
| Species | Human |
| Peptide Sequence | MGENFRNLLI |
| Peptide Length | 10 |
| Unique | No (AC010733.2-201-10aa-4,AC007743.1-201-10aa,AP001977.1-202-10aa-2,PRKG1-AS1-206-10aa-2,AC105180.2-201-10aa,AC007743.1-204-10aa-2) |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1368.55 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000280739;EIF1B-AS1 |
| Transcript ID/Name | ENST00000631175;EIF1B-AS1-206 |
| Transcript Length | 3930 |
| Coding Ability | 0.3323 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTCGCAACCTACTCATC |
|
Conservation
|
|
|