Basic information for EIF1B-AS1-207-10aa-1
| Peptide Name | EIF1B-AS1-207-10aa-1 |
| Genome Position | chr3:40081566-40081595[-] |
| Species | Human |
| Peptide Sequence | MPHLSSLLSE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.26 |
| Relative Molecular Mass | 1275.41 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000280739;EIF1B-AS1 |
| Transcript ID/Name | ENST00000655651;EIF1B-AS1-207 |
| Transcript Length | 3227 |
| Coding Ability | 0.3923 |
| DNA Sequence Corresponding to Peptide | ATGCCACATCTGTCATCCCTACTGTCTGAA |
|
Conservation
|
|
|