Basic information for Egfros-201-10aa-3
| Peptide Name | Egfros-201-10aa-3 |
| Genome Position | chr11:16818170-16818199[-] |
| Species | Mouse |
| Peptide Sequence | MLSPDVTPSG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.05 |
| Relative Molecular Mass | 1165.3 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000085091;Egfros |
| Transcript ID/Name | ENSMUST00000150329;Egfros-201 |
| Transcript Length | 4063 |
| Coding Ability | 0.4846 |
| DNA Sequence Corresponding to Peptide | ATGTTATCACCAGATGTCACTCCTTCAGGA |
m6A
|
Conservation
|
|
|