Basic information for FLG-AS1-205-10aa-1
| Peptide Name | FLG-AS1-205-10aa-1 |
| Genome Position | chr1:152366098-152366127[+] |
| Species | Human |
| Peptide Sequence | MTSHSFLRWV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1425.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237975;FLG-AS1 |
| Transcript ID/Name | ENST00000445097;FLG-AS1-205 |
| Transcript Length | 2857 |
| Coding Ability | 0.4438 |
| DNA Sequence Corresponding to Peptide | ATGACATCCCACTCCTTTCTGAGATGGGTA |
|
Conservation
|
|
|