Basic information for FLG-AS1-210-10aa-2
| Peptide Name | FLG-AS1-210-10aa-2 |
| Genome Position | chr1:152404763-152404792[+] |
| Species | Human |
| Peptide Sequence | MLIYVCDRKD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.02 |
| Relative Molecular Mass | 1417.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237975;FLG-AS1 |
| Transcript ID/Name | ENST00000653548;FLG-AS1-210 |
| Transcript Length | 1472 |
| Coding Ability | 0.2711 |
| DNA Sequence Corresponding to Peptide | ATGTTAATTTATGTATGTGACAGGAAAGAT |
|
Conservation
|
|
|