Basic information for FLG-AS1-215-10aa-5
| Peptide Name | FLG-AS1-215-10aa-5 |
| Genome Position | chr1:152313061-152313090[+] |
| Species | Human |
| Peptide Sequence | MIVPGPPVSV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.3 |
| Relative Molecular Mass | 1157.38 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000237975;FLG-AS1 |
| Transcript ID/Name | ENST00000665223;FLG-AS1-215 |
| Transcript Length | 4163 |
| Coding Ability | 0.4348 |
| DNA Sequence Corresponding to Peptide | ATGATTGTCCCTGGCCCACCTGTGAGTGTC |
m6A
|
Conservation
|
|
|