Basic information for FLG-AS1-216-10aa-1
| Peptide Name | FLG-AS1-216-10aa-1 |
| Genome Position | chr1:152364669-152364698[+] |
| Species | Human |
| Peptide Sequence | MKIPAFKSYI |
| Peptide Length | 10 |
| Unique | No (FLG-AS1-202-10aa-1,FLG-AS1-205-10aa-3,FLG-AS1-209-10aa-1,FLG-AS1-211-10aa-3,FLG-AS1-212-10aa-3,FLG-AS1-213-10aa-2,FLG-AS1-214-10aa-1,FLG-AS1-217-10aa-2,FLG-AS1-218-10aa-3) |
| Grand Average of Hydropathicity | 0.4 |
| Relative Molecular Mass | 1359.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237975;FLG-AS1 |
| Transcript ID/Name | ENST00000666686;FLG-AS1-216 |
| Transcript Length | 2580 |
| Coding Ability | 0.3973 |
| DNA Sequence Corresponding to Peptide | ATGAAAATACCAGCTTTTAAGTCATACATT |
|
Conservation
|
|
|