Basic information for FTX-210-10aa-1
| Peptide Name | FTX-210-10aa-1 |
| Genome Position | chrX:74199887-74199916[-] |
| Species | Human |
| Peptide Sequence | MALYLISFYC |
| Peptide Length | 10 |
| Unique | No (FTX-218-10aa-2) |
| Grand Average of Hydropathicity | 1.77 |
| Relative Molecular Mass | 1385.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000603037;FTX-210 |
| Transcript Length | 8347 |
| Coding Ability | 0.4725 |
| DNA Sequence Corresponding to Peptide | ATGGCTTTATACCTCATTTCCTTTTATTGC |
|
Conservation
|
|
|