Basic information for FTX-210-10aa-2
| Peptide Name | FTX-210-10aa-2 |
| Genome Position | chrX:74203841-74203870[-] |
| Species | Human |
| Peptide Sequence | MFHLTLCCIP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.63 |
| Relative Molecular Mass | 1339.68 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000603037;FTX-210 |
| Transcript Length | 8347 |
| Coding Ability | 0.4725 |
| DNA Sequence Corresponding to Peptide | ATGTTTCATTTAACATTGTGTTGTATACCT |
m6A
|
Conservation
|
|
|